| Primary Identifier | MGI:6342439 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ehbp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCGCCCATCCACTAAGA and GGCATAAATATTTATACTAG, which resulted in a 379 bp deletion beginning at Chromosome 11 position 22,172,810 bp and ending after 22,173,188 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001235276 (exon 6) and 197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 1 amino acids later. There is a 6 bp deletion CTTAGG 4 bp after the 379 bp deletion. |
