| Primary Identifier | MGI:6342494 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcdhb9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGTGAAGATTCCTCCAAAG and TATGGAAAGTCCCCACTGCA, which resulted in a 2432 bp deletion beginning at Chromosome 18 position 37,400,984 bp and ending after 37,403,415 bp (GRCm38/mm10). This mutation internally deletes 2433 bp from ENSMUSE00000413638 (exon 1) and is predicted to cause a change of amino acid sequence after residue 10, a loss of 813 amino acids, returning into frame 7 amino acids before the termination. There is a 1 bp deletion (C) 3 bp before the 2432 bp deletion. |
