| Primary Identifier | MGI:6342498 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Grxcr1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAGGTGACCATGCTAAGA and CAATTTGACCAAAGTGTTGC, which resulted in a 378 bp deletion beginning at Chromosome 5 position 68,031,909 bp and ending after 68,032,286 bp (GRCm38/mm10). This mutation deletes 378 bp of ENSMUSE00000598905 (exon 1) resulting in a change of amino acid sequence after residue 7, a loss of 126 amino acids and remains in frame. |
