| Primary Identifier | MGI:6317331 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttc29 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCCATTTTAGACCAGAGAG and GTTCAACCTATTCCACTGAG, which resulted in a 383 bp deletion beginning at Chromosome 8 position 78,246,056 bp and ending after 78,246,438 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000249377 (exon 6) and 159 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 2 amino acids later. There is a 1 bp (T) insertion at the deletion site. |
