| Primary Identifier | MGI:6317348 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mbip |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTCACCTTCACTTTCTAA and TTAGTAACTTTGAGCAAAAT, which resulted in a 2527 bp deletion beginning at Chromosome 12 position 56,339,932 bp and ending after 56,342,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314161 through ENSMUSE00000114025 (exons 2 through 4) and 2091 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 20 amino acids later. There is a 1 bp insertion (G) at the deletion site. |