|  Help  |  About  |  Contact Us

Allele : Mbip<em1(IMPC)J> MAP3K12 binding inhibitory protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6317348 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mbip
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTCACCTTCACTTTCTAA and TTAGTAACTTTGAGCAAAAT, which resulted in a 2527 bp deletion beginning at Chromosome 12 position 56,339,932 bp and ending after 56,342,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314161 through ENSMUSE00000114025 (exons 2 through 4) and 2091 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 20 amino acids later. There is a 1 bp insertion (G) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Mbip<->,
  • Mbip<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories