| Primary Identifier | MGI:6342805 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc25a42 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCGCATCCCTAACCTGC and GGTCAAGGCCTCATAGAGGC, which resulted in a 448 bp deletion beginning at Chromosome 8 position 70,191,590 bp and ending after 70,192,037 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001280784 (exon 3) and 342 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 27 and early truncation 37 amino acids later. |
