| Primary Identifier | MGI:6342842 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lrif1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACCAAGTAGTTCCTACGAT and AACAGTTGCTGCATCAACAG, which resulted in a 643 bp deletion beginning at Chromosome 3 position 106,732,447 bp and ending after 106,733,089 bp (GRCm38/mm10). This mutation deletes 643 bp of ENSMUSE00000413972 (exon 2) and is predicted to cause a change of amino acid sequence after residue 282 and early truncation 25 amino acids later. |