|  Help  |  About  |  Contact Us

Allele : Rfxap<em1(IMPC)J> regulatory factor X-associated protein; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6342848 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rfxap
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACAGGCAACGTCAAACTGG and GGAGGCGCAGGCTGTGCCCG, which resulted in a 453 bp deletion beginning at Chromosome 3 position 54,807,204 bp and ending after 54,807,656 bp (GRCm38/mm10). This mutation deletes 453 bp of ENSMUSE00000389769 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6, delete 151 amino acids then return into frame for the remaining 74 amino acids and stop codon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories