| Primary Identifier | MGI:6342848 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rfxap |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACAGGCAACGTCAAACTGG and GGAGGCGCAGGCTGTGCCCG, which resulted in a 453 bp deletion beginning at Chromosome 3 position 54,807,204 bp and ending after 54,807,656 bp (GRCm38/mm10). This mutation deletes 453 bp of ENSMUSE00000389769 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6, delete 151 amino acids then return into frame for the remaining 74 amino acids and stop codon. |