| Primary Identifier | MGI:6323008 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Polr3b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA with the spacer sequence TCATGTCCCTCAGACGGCAC resulting in a 5-bp deletion on Chr10 from 84632454 to 84632458_delGTGCC (GRCm38). |
