|  Help  |  About  |  Contact Us

Allele : Polr3b<em6(IMPC)Tcp> polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 6, The Centre for Phenogenomics

Primary Identifier  MGI:6323009 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Polr3b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0237 was generated at The Centre for Phenogenomics by injectingCas9 ribonucleoprotein complexes with a single guide RNA with the spacer sequence TCATGTCCCTCAGACGGCAC resulting in a 5-bp deletion on Chr10 from 84632454 to 84632458_delGTGCC (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories