|  Help  |  About  |  Contact Us

Allele : Polr3b<em4Tcp> polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 4, The Centre for Phenogenomics

Primary Identifier  MGI:6323010 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Polr3b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribnucleoprotein complexes with a single guide RNA having spacer sequences TCATGTCCCTCAGACGGCAC along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.308G>A at Chromosome 10 positive strand 84632459 bp (GRCm38) and is predicted to cause p.R103H.
  • mutations:
  • Single point mutation
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories