|  Help  |  About  |  Contact Us

Allele : Dennd2b<em1(IMPC)J> DENN domain containing 2B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6324043 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dennd2b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCACCGGAAGTCACAGAAC and GGGTAGATGGGACTTCTTGG, which resulted in a 1217 bp deletion beginning at Chromosome 7 position 109,556,205 bp and ending after 109,557,421 bp (GRCm38/mm10). This mutation deletes 1211 bp of ENSMUSE00000384284 (exon 3) after the first 40 bp and 6 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 36 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele