| Primary Identifier | MGI:6324235 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tbc1d32 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACAGTAGTCTTGAGCGA and GATACACTACGCAGAAACCA, which resulted in a 557 bp deletion beginning at Chromosome 10 position 56,196,322 bp and ending after 56,196,878 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000502099 through ENSMUSE00000894977 (exons 6 through 8) and 312 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 227 and early truncation 37 amino acids later. There is a 1 bp (T) insertion and a 9 bp deletion (ACGCAGAAA) 84 bp after the deletion. |
