|  Help  |  About  |  Contact Us

Allele : Tbc1d32<em1(IMPC)J> TBC1 domain family, member 32; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6324235 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tbc1d32
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACAGTAGTCTTGAGCGA and GATACACTACGCAGAAACCA, which resulted in a 557 bp deletion beginning at Chromosome 10 position 56,196,322 bp and ending after 56,196,878 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000502099 through ENSMUSE00000894977 (exons 6 through 8) and 312 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 227 and early truncation 37 amino acids later. There is a 1 bp (T) insertion and a 9 bp deletion (ACGCAGAAA) 84 bp after the deletion.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele