| Primary Identifier | MGI:6324237 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Taf5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATAACCCTGACTAGGCTGT and GCAGTACTGGATTCCTCCCA, which resulted in a 583 bp deletion beginning at Chromosome 19 position 47,074,658 bp and ending after 47,075,240 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000375459 (exon 3) and 267 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 267 and early truncation 5 amino acids later. No Taf5 transcript was detected in RNA sequencing of homozygous mutant embryos indicating complete loss of function. |
