| Primary Identifier | MGI:6324370 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam43a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCTCCTCCCCTGTCCGCG and TTTTGGATCAGACCAACTCG, which resulted in a 3280 bp deletion beginning at Chromosome 16 position 30,599,668 bp and ending after 30,602,947 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000343942 (exon 1) and 205 bp of flanking intronic sequence including the splice acceptor and donor as well as start site and is predicted to generate a null allele. |
