|  Help  |  About  |  Contact Us

Allele : Rab33b<em1(IMPC)J> RAB33B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6324683 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rab33b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGTGTCCCACAACTGGATC and CAGCACCAGCAAGTCACCGC, which resulted in a 428 bp deletion beginning at Chromosome 3 position 51,493,354 bp and ending after 51,493,781 bp (GRCm38/mm10). This mutation deletes 426 bp of the coding sequence (leaving the last 15 bases) of ENSMUSE00000387710 (exon 2) including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 54 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories