| Primary Identifier | MGI:6324683 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab33b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGTGTCCCACAACTGGATC and CAGCACCAGCAAGTCACCGC, which resulted in a 428 bp deletion beginning at Chromosome 3 position 51,493,354 bp and ending after 51,493,781 bp (GRCm38/mm10). This mutation deletes 426 bp of the coding sequence (leaving the last 15 bases) of ENSMUSE00000387710 (exon 2) including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 54 amino acids later. |
