|  Help  |  About  |  Contact Us

Allele : 1700008P02Rik<em1(IMPC)J> RIKEN cDNA 1700008P02 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6382049 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  1700008P02Rik
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCACTCTCAGGTTGAT and GGCAAAAGGCTGGGGCTGAC, which resulted in a 348 bp deletion beginning at Chromosome 3 position 6,620,010 bp and ending after 6,620,357 bp (GRCm38/mm10). This mutation deletes 348 bp of ENSMUSE00000569619 (exon 1) and is predicted to cause a change of amino acid sequence after residue 11 for 1 amino acid then return to frame for 47 amino acids before termination.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories