| Primary Identifier | MGI:6382049 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 1700008P02Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCACTCTCAGGTTGAT and GGCAAAAGGCTGGGGCTGAC, which resulted in a 348 bp deletion beginning at Chromosome 3 position 6,620,010 bp and ending after 6,620,357 bp (GRCm38/mm10). This mutation deletes 348 bp of ENSMUSE00000569619 (exon 1) and is predicted to cause a change of amino acid sequence after residue 11 for 1 amino acid then return to frame for 47 amino acids before termination. |