|  Help  |  About  |  Contact Us

Allele : Cldn11<em1(IMPC)H> claudin 11; endonuclease-mediated mutation 1, Harwell

Primary Identifier  MGI:6355928 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cldn11
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  his allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences TGCCGAAAAATGGACGAACTGGG, AGTTCTCCCCTGCATCCGAATGG, GTTCTCCCCTGCATCCGAATGGG, CATCCCCACCTGCCGAAAAATGG, which resulted in an intragenic deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories