| Primary Identifier | MGI:6356016 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr125 |
| Strain of Origin | Not Specified | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | NKX2-5 binding enhancer M10, upstream of Furin, was targeted with two sgRNAs (targeting ATGCGGTTGTGATCTCTCGG and GCCACCGGCAAAGGCGTGGT) using CRISPR/Cas9 technology, resulting in an 896 bp deletion in line 676. |
