|  Help  |  About  |  Contact Us

Allele : Rr125<em1Tmhm> regulatory region 125; endonuclease-mediated mutation 1, Tim Mohun

Primary Identifier  MGI:6356016 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr125
Strain of Origin  Not Specified Is Recombinase  false
Is Wild Type  false
molecularNote  NKX2-5 binding enhancer M10, upstream of Furin, was targeted with two sgRNAs (targeting ATGCGGTTGTGATCTCTCGG and GCCACCGGCAAAGGCGTGGT) using CRISPR/Cas9 technology, resulting in an 896 bp deletion in line 676.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Furin<em1Tmhm>,
  • Furin<deltaM10>,
  • Furin<em1Tmhm>,
  • Furin<deltaM10>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele