|  Help  |  About  |  Contact Us

Allele : AI467606<em1Ciphe> expressed sequence AI467606; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique

Primary Identifier  MGI:6357866 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  AI467606
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with sgRNAs (targeting GCTCCCTGAGCCTACAGCGGAGG and AGCGTGCCCCCACCCTAGTCTGG) using CRISPR/Cas9 technology, resulting in a 197 bp deletion in the 5' end of the CDS in exon 2.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories