| Primary Identifier | MGI:6357930 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nat14 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAAGACACGGAAAACCGTG and CATGGGCTATATGCTGGTTA, which resulted in a 510 bp deletion beginning at Chromosome 7 position 4,923,920 bp and ending after 4,924,429 bp (GRCm38/mm10). This mutation deletes 510 bp of ENSMUSE00000494728 (exon 3) and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 5 amino acids later. |
