| Primary Identifier | MGI:6357937 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp697 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAAAGGGCTATCCTCCGTG and CAGAAGTTGCACTTGTGTTA, which resulted in a 1360 bp deletion beginning at Chromosome 3 position 98,427,181 bp and ending after 98,428,540 bp (GRCm38/mm10). This mutation deletes 1360 bp from ENSMUSE00000467437 (exon 3) and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 44 amino acids later. |
