|  Help  |  About  |  Contact Us

Allele : Pdxp<em1(IMPC)J> pyridoxal (pyridoxine, vitamin B6) phosphatase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6357839 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pdxp
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATTGGCTGGGAAGCGCA and GGCAAAATGTATCTGCGCTG, which resulted in a 5911 bp deletion beginning at Chromosome 15 position 78,913,713 bp and ending after 78,919,623 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000557887, ENSMUSE00000557885 (exons 1,2) and 3910 bp of flanking intronic sequence including the transcription start, splice acceptor and donor and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories