| Primary Identifier | MGI:6357839 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pdxp |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATTGGCTGGGAAGCGCA and GGCAAAATGTATCTGCGCTG, which resulted in a 5911 bp deletion beginning at Chromosome 15 position 78,913,713 bp and ending after 78,919,623 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000557887, ENSMUSE00000557885 (exons 1,2) and 3910 bp of flanking intronic sequence including the transcription start, splice acceptor and donor and is predicted to generate a null allele. |