| Primary Identifier | MGI:6357989 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Clec3a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCTCCTAATCCCTTTGGG and GTAGGCCCCCTCAGTAAACT, which resulted in a 730 bp deletion beginning at Chromosome 8 position 114,425,191 bp and ending after 114,425,920 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365573 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 23 amino acids later. |
