| Primary Identifier | MGI:6358077 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Traf3ip1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences AGCACAGCCCTGCCGCATTTGGG, TCTGGTCAGAGTGTGGTAGCTGG, AGATTATCTTGTTTGTTCCTTGG, TGATATGCACAGTATCTTGGTGG, which resulted in a 2.3 kb deletion that includes exons 6 and 7 and is predicted to result in a frameshift mutation and nonsense mediated decay. |
