| Primary Identifier | MGI:6357892 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf217 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCAGGGCATATAAGTCAG and GCCATGTTACAGGATCATAA, which resulted in a 2551 bp deletion beginning at Chromosome 10 position 31,503,602 bp and ending after 31,506,152 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463122 and ENSMUSE00000464525 (exons 4 and 5) and 2237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 400 and truncation 55 amino acids later by read through into the 3 UTR. |
