|  Help  |  About  |  Contact Us

Allele : Etv2<em1Djg> ets variant 2; endonuclease-mediated mutation 1, Daniel J Garry

Primary Identifier  MGI:6358103 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Etv2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The 3.9-kb promoter upstream of Etv2 was deleted using gRNAs (targeting AATGCAAGCTTACCCCCAGC and GCCAGAGGTGAGCCACGAAC) with CRISPR/Cas9 technology.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Etv2 Mut,
  • Etv2 Mut
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories