|  Help  |  About  |  Contact Us

Allele : Nab1<em1(IMPC)H> Ngfi-A binding protein 1; endonuclease-mediated mutation 1, Harwell

Primary Identifier  MGI:6358624 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nab1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NTac
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences TGATAAACCCGGAATCAATCTGG, CCTCCGACCTGAGAACTTGACCA, CCGACCTGAGAACTTGACCAGTA, CTGCTAGCTAATGTCAAGAGAGG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories