| Primary Identifier | MGI:6360661 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pgap1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAGGGGGAATAGATTATAG and AGTTATCGTTTTTCACGCAG, which resulted in a 615 bp deletion beginning at Chromosome 1 position 54,550,691 bp and ending after 54,551,305 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000602220 (exon 2) and 461 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 69 amino acids later. |
