| Primary Identifier | MGI:6360664 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dennd6b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAATGAGCAAAACCCGGA and TGATCCTGCAGACAACACAT, which resulted in a 571 bp deletion beginning at Chromosome 15 position 89,189,967 bp and ending after 89,190,537 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000380969 (exon 4) and 458 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 50 amino acids later. |
