|  Help  |  About  |  Contact Us

Allele : Nap1l3<em1(IMPC)J> nucleosome assembly protein 1-like 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6360667 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nap1l3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCTGAAGTCATGGTAGT and TCACAGAACCTGGTGCCCAT, which resulted in a 1549 bp deletion beginning at Chromosome X position 122,395,429 bp and ending after 122,396,977 bp (GRCm38/mm10). This mutation deletes 1549 bp of ENSMUSE00000471845 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 17 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories