| Primary Identifier | MGI:6360667 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nap1l3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCTGAAGTCATGGTAGT and TCACAGAACCTGGTGCCCAT, which resulted in a 1549 bp deletion beginning at Chromosome X position 122,395,429 bp and ending after 122,396,977 bp (GRCm38/mm10). This mutation deletes 1549 bp of ENSMUSE00000471845 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 17 amino acids later. |