| Primary Identifier | MGI:6359789 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gk2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele represents a pool of two possible out-of frame deletion null alleles created using an sgRNA (TTGGAAGGCGTGCCAATATC) and CRISPR/Cas9 technology: a two-base deletion of reverse strand AT (c.759_760del) (Gk2em1Juhu) and/or a 14-base deletion of reverse strand CCAATATCTGGATG (c.754_767del) (Gk2em2Juhu). This allele is used where the specific allele or allele combination is not specified. |