|  Help  |  About  |  Contact Us

Allele : Gk2<em#Juhu> glycerol kinase 2; endonuclease-mediated mutation, Junjiu Huang

Primary Identifier  MGI:6359789 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gk2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  This allele represents a pool of two possible out-of frame deletion null alleles created using an sgRNA (TTGGAAGGCGTGCCAATATC) and CRISPR/Cas9 technology: a two-base deletion of reverse strand AT (c.759_760del) (Gk2em1Juhu) and/or a 14-base deletion of reverse strand CCAATATCTGGATG (c.754_767del) (Gk2em2Juhu). This allele is used where the specific allele or allele combination is not specified.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Gk2 KO,
  • Gk2<->,
  • Gk2<->,
  • Gk2 KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele