| Primary Identifier | MGI:6390579 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Taar8a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAAAAAGGATTTATAACCG and GTATTTTTCTAGCTTCATAA, which resulted in a 1239 bp deletion beginning at Chromosome 10 position 24,076,376 bp and ending after 24,077,614 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001051733 (exon 1) and 204 bp of flanking intronic sequence including the splice acceptor, donor and start site. This mutation is predicted to generate a null allele. |