| Primary Identifier | MGI:6360916 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mgst1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGTCGATGCTAGTTGAGCCT and GTATGCAGGAGACAGAGCAC, which resulted in a 467 bp deletion beginning at Chromosome 6 position 138,150,680 bp and ending after 138,151,146 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001207752 (exon 3) and 372 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 4 amino acids later. |
