| Primary Identifier | MGI:6361007 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Elp6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATGAGGAAGGCCTAGCCG and GCCATCCTCCCAGCAAATGA, which resulted in a 1813 bp deletion beginning at Chromosome 9 position 110,312,464 bp and ending after 110,314,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000220060 and ENSMUSE00000220064 (exons 3 and 4) and 1623 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 18 amino acids later. |
