| Primary Identifier | MGI:6360686 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcdh11x |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCCAACTGATTGTTCAAA and GGTCTGATATGCACAGACAC, which resulted in a 2408 bp deletion beginning at Chromosome X position 120,399,472 bp and ending after 120,401,879 bp (GRCm38/mm10). This mutation deletes 2408 bp from ENSMUSE00000435881 (exon 3) and is predicted to cause a change of amino acid sequence after residue 203 and early truncation 51 amino acids later. |
