| Primary Identifier | MGI:6360721 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm5447 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTGCCCAAGAGTCCACAG and CCATAAGCCCTAAGGTTTGA, which resulted in a 211 bp deletion beginning at Chromosome 13 position 30,974,433 bp and ending after 30,974,643 bp (GRCm38/mm10). This mutation deletes 211 bp of non-coding ENSMUSE00000431669 (exon 1) and is predicted to result in disruption of the regulatory build in this genome region. |
