|  Help  |  About  |  Contact Us

Allele : Rnf180<em1(IMPC)J> ring finger protein 180; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6360732 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rnf180
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAACGATGGCTACAGAAGC and CAGTTTCCCAACTGTCCACT, which resulted in a 953 bp deletion beginning at Chromosome 13 position 105,249,611 bp and ending after 105,250,563 bp (GRCm38/mm10). This mutation deletes 953 bp of ENSMUSE00000436977 (exon 4) and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 11 amino acids later. There is a 1 bp (A) insertion at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories