| Primary Identifier | MGI:6360732 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf180 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAACGATGGCTACAGAAGC and CAGTTTCCCAACTGTCCACT, which resulted in a 953 bp deletion beginning at Chromosome 13 position 105,249,611 bp and ending after 105,250,563 bp (GRCm38/mm10). This mutation deletes 953 bp of ENSMUSE00000436977 (exon 4) and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 11 amino acids later. There is a 1 bp (A) insertion at the deletion site. |