| Primary Identifier | MGI:6361166 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mecom |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTTGACAAGTTTGCTCGG and GTGTAACTCCATAAGACGGC, which resulted in a 365 bp deletion beginning at Chromosome 3 position 29,993,409 bp and ending after 29,993,773 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001214312 (exon 4) and 151 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 29 amino acids later. |
