| Primary Identifier | MGI:6376255 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ctf2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGAGGAGGTCAGGAGTAA and CATGACACAATCAATCAGCC, which resulted in a 396 bp deletion beginning at Chromosome 7 position 127,723,008 bp and ending after 127,723,403 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000492582 (exon 2) and 256 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 8 and early truncation 6 amino acids later. |