| Primary Identifier | MGI:6376261 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ube2q2l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACACCATAGCAACTGCACAA and GATGGATTCTCCATGCTAAA, which resulted in a 1677 bp deletion beginning at Chromosome 6 position 136,400,277 bp and ending after 136,401,953 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001369384 (exon 2) and 107 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. |
