|  Help  |  About  |  Contact Us

Allele : Tg(Foxa2-EGFP)1Jbri transgene insertion, James Briscoe

Primary Identifier  MGI:6376096 Allele Type  Transgenic
Attribute String  Reporter Gene  Tg(Foxa2-EGFP)1Jbri
Strain of Origin  FVB/N Is Recombinase  false
Is Wild Type  false
molecularNote  Eight concatemerized fragments of a FoxA2 enhancer that contains a Gli binding site (GBS; TTATGACGGAGGCTAACAAGCAGGGAACACCCAAGTAGAAGCTGGCTGTC) and hsp68 minimal promoter drivie expression of an EGFP reporter gene. The transgene is flanked by two copies of the chicken beta-globin insulator. The pound symbol (#) is used when no line is specified and/or lines are pooled.
  • mutations:
  • Insertion
  • synonyms:
  • Tg(GBS-GFP)Jbri,
  • Tg(GBS-GFP)Jbri,
  • 8GBS-hsp68-eGFP,
  • 8GBS-hsp68-eGFP
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories