| Primary Identifier | MGI:6376096 | Allele Type | Transgenic |
| Attribute String | Reporter | Gene | Tg(Foxa2-EGFP)1Jbri |
| Strain of Origin | FVB/N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Eight concatemerized fragments of a FoxA2 enhancer that contains a Gli binding site (GBS; TTATGACGGAGGCTAACAAGCAGGGAACACCCAAGTAGAAGCTGGCTGTC) and hsp68 minimal promoter drivie expression of an EGFP reporter gene. The transgene is flanked by two copies of the chicken beta-globin insulator. The pound symbol (#) is used when no line is specified and/or lines are pooled. |