| Primary Identifier | MGI:6376198 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Echdc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATTTAGGTAGAAAAAT and AGTTATAGTACTAAGCACAC, which resulted in a 458 bp deletion beginning at Chromosome 10 position 29,322,031 bp and ending after 29,322,488 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001307826 (exon 3) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 42 amino acids later. There is a 10 bp insertion (TTATAGTACT) at the deletion site. |
